Eight weeks of high intensity interval training improve the expression of interleukin-17 and interleukin-18 genes in the heart tissue of cadmium-poisoned rats

Journal of Physical Activity and Hormones

مقاله 6، دوره 2، شماره 1 - شماره پیاپی 5، اردیبهشت 2018، صفحه 61-76   

نوع مقاله: Original Article

نویسندگان

Ahmad Ahmadloo¹؛ Sirous Farsi^{* 2}؛ Mohammad Ali Azarbayjani³

¹Ph.D candidate in Exercise Physiology, Department of Physical Education, Larestan branch, Islamic Azad University, Larestan, Iran

²Assistant Professor in Exercise Physiology, Department of Physical Education, Larestan branch, Islamic Azad University, Larestan, Iran

³Professor in Exercise Physiology, Department of Physical Education, Central Tehran branch, Islamic Azad University, Tehran, Iran

چکیده

Introduction: lL-17 and IL-18 are pro-inflammatory cytokines. The aim of present study is to evaluate the effect of endurance training on IL-17 and IL-18 in heart tissue of rats which have been poisoned by cadmium.
Material & Methods: Twenty Wistar rats were randomly divided into four groups: 1) control, 2) sham, 3) cadmium and 4) high intensity interval training (HIIT training) with cadmium. HIIT training was performed 8 weeks and 3 days a week (80 to 110% of their VO_2max). Cadmium groups received 2mg/kg cadmium intraperitoneally everyday. At the end of protocol, the rats were sacrificed and their heart tissues were prepared to measure gene expression of IL-17 and IL-18. The data was analyzed by independent sample t-test and one-way ANOVA (P≥ 0.05).
Results: The HIIT training led to significantly reducing IL-17 and IL-18 gene expression in heart issue of rats (P= 0.001).
Conclusion: The 8 weeks of HIIT training will improve the levels of pro-inflammatory cytokines in rats which have been poisoned by cadmium.

کلیدواژه‌ها

Cadmium؛ HIIT training؛ IL-17؛ IL-18

اصل مقاله

Introduction

Nowadays, environmental pollution is one of the problems of human health in industrialized and developed countries. Extensive studies have shown that exposure to airborne contamination and inhalation of heavy metals in the air and the consumption of food contaminated with these substances is associated with an increase in inflammation in the cardiovascular system, resulting in cardiovascular disease and even death (1,2). In addition, through the production of free radicals, and thus an increase in inflammation, the toxic effects of these heavy metals may impair the function of various organs in the body, including the cardiovascular system (1,3). In fact, one of the factors that increase inflammation and the prevalence of cardiovascular disease is the presence of cadmium in air and soil (4). Actually, an evidence suggests that exposure to cadmium is associated with an increased risk of cardiovascular disease, including high blood pressure and heart tissue damage (5). Products containing cadmium, such as batteries, electronic devises, jewelry and toys, as well as fertilizers containing cadmium through soil and food, threaten people’s lives (6,7). According to available research, cadmium levels are high in people with inflammatory cardiovascular disease (8). Cadmium causes an increase in the level of pre-inflammatory cytokines such as interleukins, which causes the development of atherogenic plaques in coronary arteries (9). Recent research has shown that inflammation plays a key role in coronary artery disease (CAD). In addition, inflammation is related to the two inflammatory factors of IL-17 and IL-18 in the heart tissue. Interleukin 18 (IL-18), a pro-inflammatory cytokine, is a member of the family of interleukin-1 cytokines, which is originally described as an interferon-gamma-inducing factor (9). Also, in most cardiovascular patients, the level of IL-18 is high, indicating a direct relationship with cardiovascular disease (10). Another inflammatory cytokines that play a major role in cardiovascular disease is IL-17. IL-17 is a pro-inflammatory cytokine derived from CD4, but play a role in the spread of inflammatory diseases in the tissue (11). Considering the harmful effects of cadmium on the cardiovascular system, and the increasing probability in exposure to air pollution on the one hand, and the impact of adopting an inappropriate life style, including the lack of systematic physical activity (12) on the other hand, researchers have investigated different strategies to neutralize the harmful effects of cadmium on inflammation of the cardiovascular system. It has been suggested that regular physical activity plays an important role in the improvement of inflammation from cadmium (13, 14, 18-20). Physical activity is a well-known and applied method for reducing inflammation and risk of cardiovascular disease (23). Blair et al. have reported that regular physical activity has an inverse relationship with blood level of inflammatory markers and eliminates chronic inflammation (18). In addition, Dorneles et al (2016), in the study of obese and lean men, concluded that HIIT exercises reduced IL-8 and increased IL-6 and IL-18 without altering IL-17 (24). It has also been shown that after regular HIIT activities IL-18 concentrations were lower than that of non-athletes (25). Numerous studies have confirmed the fact that severe interval exercises increase the levels of pre-inflammatory cytokines such as IL-6, IL-17 and IL-18 in athlete's body, and on the other hand, regular intensive endurance exercises with mean severity modifies these cytokines in various tissues, including the cardiovascular system (26-28). Also, Daryanoosh et al. (2013) concluded that high intensity interval exercises reduce inflammatory cytokines such as interleukin 6 and alpha necrosis factor (30). No studies have been found to investigate the effects of HIIT exercises on levels of IL-17 and IL-18 in conditions exposed to cadmium poisoning, and considering the harmful effects of cadmium. So, the purpose of this study was to investigate the effect of HIIT exercises on the inflammation in the heart tissue of cadmium-poisoned rats.

Material & Methods

Animals

The present study was approved by the Ethic Committee on Animal Use of Larestan branch, Islamic Azad University, Larestan, Iran. Twenty adult male Wistar rats weighing 184.9 ± 15.6 g (at the beginning of the study) were used in this experiment. The animals were kept in accordance with the Guideto the Care and Use of Experimental Animals (1993).

Rats were submitted to seven days of acclimatization in polypropylene boxes (dimensions 41 cm × 34 cm × 17.5 cm), containing wood shavings (for absorbing urine and water). Five rats were placed in each box. Throughout the experimental period, rats were housed under controlled temperature (20°C ± 2°C), humidity (45% ± 15%) and lighting conditions (7:00 a.m. to 19:00 p.m.) with food and water made available ad libitum. Animals were randomly divided into four groups (n=5 in each group): control, sham, cadmium and HIIT training with cadmium group. For 8 weeks, the rats of cadmium and HIIT training with cadmium groups received 2 mg/kg cadmium per day (29). It should be noted that sham group rats received peritoneal cadmium solvent in the entire study period.

 

Treadmill exercise protocol

High intensity interval exercise protocol consisted of three parts, including warming up (5 minutes), exercise including 2-minute (2 × 2) interval phases (with an active 2 minute recovery interval between each set) and cool-down (5 minutes). First, the rats warmed up to the treadmill with a maximum intensity of 50 to 60% of VO_2max for 5 minutes. The interval exercises included a combination of high intensity and low intensity interval phases. High intensity interval phases included 2 minutes exercises with maximum intensity of 80% VO_2max in the first week, maximum intensity of 90% VO_2max in the second week, maximum intensity of 100% VO_2max in the third week and maximum intensity of 110% VO_2max from the beginning of the fourth week until the end of the training, and low intensity interval phases (Recovery Interval) included 2 minutes with a maximum intensity of 50% VO_2max. After performing the last high intensity interval phases, the rats performed cooling with a maximum intensity of 50 to 60% VO_2max for 5 minutes (figure 1). Initially, the standard test of Bedford et al. (1979) was used to determine the maximum oxygen consumption (32). This test included 10 three-minute stages. The speed at the first stage was 0.3 km / h and in the next steps, 0.3 km / h was added to the treadmill speed, while at all the steps the slope was zero. At each stage of the test, when the animal was no longer able to continue, the velocity at that stage was considered to be the equivalent of the speed of the animal at the maximum oxygen consumption.

 

 

Figure 1. HIIT program

 

At the end of the study period, 48 hours after the last training session, the rats were anesthetized by ketamine and xylazine and then their heart tissues were removed to measure the research variables.

 

Measurement of mRNA expression by RT-PCR

For molecular analysis at the gene expression level, first, extraction of RNA from the heart tissue was carried out according to the manufacturer's protocol (Sina Gene, Iran), and then, using the light absorption property at 260 nm wave length, with the following equation, the concentration and purity of the sample RNA was quantitatively obtained.

 

C (µg/µl) = A260× ɛ× d/1000

 

After extracting RNA with high purity and high concentration, all of the study samples were taken cDNA synthesis steps according to the manufacturer's protocol, and then synthesized cDNA was used for reverse transcription reaction. At first, designed primers for genes were studied, and then genes expression was evaluated using q-RT PCR quantitative method. The sequence of primers used in the study includes:

 

IL-17 (f)                      CCGTTCCACTTCACCCTG

IL-17 (r)                      GTCCAACTTCCCCTCAGC

                                                           

IL-18 (f)                      ATGTCTACCCTCTCCTGT

IL-18 (r)                      TTCCATTTTGTTGTGTCCTG

 

Statistical analysis

Data analyses were performed using SPSS software for windows. Results were expressed as the mean ± SD, one-way ANOVA (P≤0.05), Kolmogorov-smirnov tests and distributions of all variables were assessed for normality.

 

Results

Table 1 shows the weight of rats in different groups

 

Table 1. Weight of Rats in the Four Groups

Group	First Week	Last Week
Control	184.80 ± 7.69	201.00 ± 15.03
Sham	180.00 ± 20.94	199.40 ± 40.69
Cadmium	149.80 ± 20.42	157.80 ± 22.85
Cadmium and HIIT	115.80 ± 4.26	118.00 ± 4.63

 

The expression levels of IL-17 and IL-18 in the four groups of the study are presented in Table 2.

 

Table 2: Expression Level of IL-17 and IL-18 in the Four Groups

Group Variable	IL-17 (Mean ± SD)	IL- 18  (Mean ± SD)
Control	0.0144 ± 0.0041	0.0053 ± 0.0003
Sham	0.0152 ± 0.0068	0.0047 ± 0.0007
Cadmium Consumption	0.8128 ± 0.1561	0.9134 ± 0.4506
HIIT + cadmium	0.022 ± 0.022	0.011 ± 0.002

The results of the one-way ANOVA presented in Table 3 show that eight weeks of HIIT had a significant effect on IL-17 expression (P = 0.028 and F = 8.4449 with effect size of 0.301) and IL-18 (P = 0.002 and F = 14.168 with effect size of 0.470) of cadmium-poisoned rats.

 

Table 3: the Effect of HIIT on the expression of IL-17 and IL-18 in Cadmium-Poisoned Rats

Variable	Statistics Factor	F	Significance Level	Effect Size
IL-17	HIIT	8.449	0.028	0.301
IL-18	HIIT	14.168	0.002	0.470

 

The results of tukey post hoc test illustrated which eight weeks of cadmium consumption led in increasing the expression of IL-17 and IL-18 of cadmium-poisoned rats. In addition, the results showed that HIIT training could change the expression of IL-17 and IL-18 in cadmium-poisoned rats.

 

Table 4. The results of tukey post-hoc so as to compare the meaning of IL-17 between groups

Levels of comparisons		sig
placebo	Cadmium	0.0001
	Control	0.03
	HIIT Training	0.001
cadmium	Control	0.0001
	HIIT Training	0.0001
control	HIIT Training	0.01

 

 

 

 

 

 

 

 

Table 5. The results of tukey post-hoc so as to compare the meaning of IL-18 between groups

Levels of comparisons		sig
placebo	Cadmium	0.002
	Control	0.01
	HIIT Training	0.02
cadmium	Control	0.002
	HIIT Training	0.002
control	HIIT Training	0.03

 

 

 

 

 

 

 

Discussion

The findings of the present study indicated that exercise decreases IL-17 and IL-18 significantly in the heart tissue of cadmium-poisoned rats. In fact, the serious problem of cadmium is the induction of inflammatory reactions in various organs of the human and the animal body. Changes in the synthesis of nitric oxide and free radicals, which play an important role in the development of inflammation in various tissues, including the heart, are the possible mechanisms of inflammatory activity of cadmium in various tissues. Based on available research, in patients with inflammatory cardiovascular diseases and arterial cramps, cadmium levels are high (24). Therefore, cadmium increases the level of inflammatory cytokines such as interleukins, which causes the development of atherosclerotic plaques in coronary arteries (25). In fact, cellular mechanisms that cadmium causes damaging the endothelium include the release of pro-inflammatory mediators such as the alpha-necrosis factor, and interleukins 17 and 18, and the antitrombolitic elements of vascular endothelial cell culture (26). For this purpose, the present study found that HIIT exercises lead to a significant reduction of IL-17 and IL-18 in cadmium-infected rats. But some study findings are not consistent with the results of present study. For example, Dorneles et al. (2016), in their study on obese and lean men, concluded that HIIT exercises reduced IL-8 and increased IL-6 and IL-18 without altering IL-17 (15). Robeson Ansley et al. (2007) showed that performing intensive interval exercises can suppress the intrinsic immune system and increase the incidence of pro-inflammatory cytokines such as interleukin 6, 17 and 18 (27). Tofighee et al., (2014) after a semi-experimental study, stated that severe exercise had no significant effect on IL-17 levels compared to pre-exercise, which was due to  short periods of exercise (28). Therefore, another important factor in secretion of these cytokines is the duration of the exercise. Indeed, much of the research has pointed to increased cytokine, which is probably due to the intensity of exercise, which liberates pro-inflammatory cytokines and anti-inflammatory cytokines through leukocytes and skeletal muscles. However, the effect of exercise intensity on levels of IL-17 and IL-18 in some studies is considered as an important factor. For example, Duzova et al., (2009) in their study investigated the effect of two types of exercise programs of running on a roller belt (high intensity exercise: 85% of maximum oxygen consumption with slope, and light exercise: 50 to 60% of maximum oxygen consumption without slope) and found that after 8 weeks, the level of these cytokines increased in the group that used intensive exercise, but in the other group there was no significant change (29). On the other hand, results of some other studies confirm the present study findings which can be due to the duration and intensity of exercises. For instance Daryanoosh et al. (2013) concluded that intensive interval exercises reduced inflammatory cytokines such as interleukin 6 and alpha necrosis factor (30). Also, in a comprehensive study, researchers found that performing 8 weeks of regular HIIT exercises can significantly reduce levels of inflammatory cytokines such as IL-17 and IL-18 (31). In this regard, Leggate et al., (2012) in a study, showed that levels of inflammatory cytokines, including interleukins 6, 17 and 18 in those who carry out HIIT exercises were low (32). In addition, Nikseresht et al. (2014) in their study on middle-aged obese men concluded that intensive interval exercises compared with endurance exercises had better efficacy on inflammatory cytokines (33). Also, some studies have indicated that HIIT exercises protect heart tissue by modulating the bad effects of cadmium in the body (25). This means that the type of intensity and duration of aerobic exercises, which took place in the present study with a relatively long time and moderate intensity, is an important and essential factor in reducing the inflammatory cytokines caused by environmental contamination such as exposure to cadmium. Tofighee et al., (2014) after a semi-experimental study, stated that severe exercise had no significant effect on IL-17 levels compared to pre-exercise, which was due to exercises short periods (28). So another important factor in secreting these cytokines is the duration of exercise. In fact, most of the research has pointed to the increase in this cytokine, which is probably due to the intensity of exercise, which liberates pro-inflammatory cytokines and anti-inflammatory cytokines through leukocytes and skeletal muscle (34) HIIT, however, can produce similar results to endurance training including muscle oxidative capacity and mitochondrial enzyme activity, but in addition to providing various cardiometabolic benefits HIIT is also very time-efficient. The lack of large-scale post-HIIT or post-ET inflammatory responses indicates that a regimen of two to three HIIT sessions per week may noticeably aid in improving general health and fitness such as body fat percentage, maximal oxygen uptake, and cardiovascular endurance while exerting relatively little stress on the immune system in untrained and healthy young adults (35-37). Finally, despite all controls imposed on the sex, race and weight of the animals, environmental factors (such as light, temperature and sound, etc.), the exercise program and animal feed, the lack of measurement of the rate of absorption of cadmium in the heart tissue and also, the lack of control over night activity are the limitations of this research. In spite of the above, considering the increasing use of cadmium in air and food products and its harmful effects on heart tissue health, the controlled review of affordable and safe non-prescriptive strategies, such as various physical activities, for instance, swimming exercises, endurance exercises and herbal antioxidant supplements, especially in the presence of other pollutants in animal species for longer duration, can be considered as a fundamental research for future human research.

 

Conclusion

The results of this study showed that performing HIIT exercises significantly reduces the levels of IL-17 and IL-18 which can increase inflammation due to cadmium intake. Therefore, these exercises protect the heart tissue from inflammation caused by cadmium intake.

 

Acknowledgment

The present study is the result of a doctoral dissertation approved by Islamic Azad University of Larestan which is under the scientific support of that university.

 

Conflict of interests

No conflict of interests amongst authors.

مراجع

Referecences

1. Gurer H, Ercal N. Can antioxidants be beneficial in treatment of lead poisoning? Free Radic Biol Med 2000; 29: 927-945.

2. Simkhovich BZ, Kleinman MT, Kloner RA. Air Pollution and Cardiovascular Injury. Epidemiology, Toxicology, and Mechanisms. JAm Coll Cardiol 2008; 52: 719-726.

3. Ademuyiwa O, Agarwal R, Chandra R, Behari JR. Lead-induced phospholipidosis and cholesterolgenesis in rat tissues. Chem Biol Interact 2009; 179: 314-320.

4. Christopher JK, Hame tt, Prapavessis H, Chris Bald J, Varo N, Schoenbeck V, et al. Effects of exercise training on 5 inflammatory markers associated with cardiovascular risk. American heart J 2006; 151: 367-387.

5. Puri VN. Cadmium induced hypertension. Clin Exp Hypertens 1999; 21: 79-84.

6. Ding YH, Young CN, Luan X, Li J, Rafols JA, Clark JC, et al. Exercise preconditioning ameliorates inflammatory injury in ischemic rats during reperfusion. Acta neuropathol (Berl) 2005; 109: 237-46.

7. Laura E, Dick S, Paul L, Erik S. Exercise, cognition and Alzheimer’s disease: More is not necessarily better. Neurosci Biobehav Rev 2006; 30: 562-575.

8. Aggarwal BB, Harikumar KB. Potential therapeutic effects of curcumin, the antiinflammatory agent, against neurodegenerative, cardiovascular, pulmonary, metabolic, utoimmune and neoplastic diseases. Int J Biochem Cell Biol 2009; 41: 40-59.

9. Anthony Z, Eza L, Bagus PPW, Xin J, Komang S, Grace DS. High dietary turbine reduces apoptosis and atherosclerosis in the left main coronary artery; association with reduce CCAAT/enhancer binding protein homologous protein and total plasma homocysteine but not lipidemia. Hypertension 2009; 53: 1017-1022.

10. Barbara JMH, Jefferis A, Olia Papacosta A, Christopher G, Owen BS, Goya Wannamethee A, et al. Interleukin 18 and coronary heart disease: Prospective study and systematic review. Atherosclerosis 2011; 219:970

11. Moseley TA, Haudenschild DR, Rose L, Reddi AH. Interleukin-17 family and IL-17 receptors”. Cytokine Growth Factor Rev 2003; 14:155-74.

12. Jarup L, Akesson A. Current status of cadmium as an environmental health problem. Toxicol Appl Pharmacol 2009; 238: 201-208.

13. Tuomisto K, Jousilahti P, Sundvall J, Pajunen P, Salomaa V. C-reactive protein, interleukin-6 and tumor necrosis factor alpha as predictors of incidentcoronary and cardiovascular events and total mortality. A population-based, prospective study. Thromb Haemost 2006; 95: 511-518

14. Blair SN, Cheng Y, Holder JS. Is physical activity or physical fitness more important in defining health benefits? Med Sci Sports Exerc 2001; 33: 379-399

15. Dorneles GP, Haddad DO, Fagundes VO, Vargas BK, Kloecker A. High intensity interval exercise decreases IL-8 and enhances the immunomodulatory cytokine interleukin-10 in lean and overweight–obese individuals. Cytokine 2016; 77: 1-9

16. Yamaoka-Tojo M, Tojo T, Wakaume K. Circulating interleukin-18: a specific biomarker for atherosclerosis-prone patients with metabolic syndrome. Nutrition and Metabolism 2011; 8: 34-41.

17. Fichtlscherer S, Rosenberger G, Walter DH, Breuer S, Dimmeler S, Zeiher AM. Elevated Creactive protein levels and impaired endothelial vasoreactivity in patients with coronary artery disease. Circulation 2000; 102: 1000-1006.

18. Ravasi AA, Aminian T, Gaeini AA, Haghighi AH. Effect of continues training on proinflammatory cytokines and insulin resistance in obese male. Harekat 2005; 28: 57-66.

19. Ruiz J, Ortega F, Meusel D, Sjöström M. Traditional and novel cardiovascular risk factors in school-aged children: A call for the further developpment of public health strategies with emphasis on fitness. J Public Health 2007; 15: 171-177.

20. Gregory S, William F, Tom S. Correlation of hepatic metallothionein concentrations with acute cadmium toxicity in the mouse. Toxicol Appl Pharmacol 1977; 39: 61-69.

21. Thijssen S, Maringwa J, Faes C, Lambrichts I, Van Kerkhove E. Chronic exposure of mice to environmentally relevant, low doses of cadmium leads to early renal damage, not predicted by blood or urine cadmium levels. Toxicology 2007; 229: 145-156.

22. Agha-Alinejad H, Haftchenari SH, MatinHomaei H. Effect of a Period of Endurance Training on Serum Il-8 Concentration and Tumor Volume in Breast Cancer BearingMice. Iranian Journal of Endocrinology and Metabolism 2014; 16: 28-32.

23. Bedford T, Tipton C, Wilson N, Oppliger R, Gisolfi C. Maximum oxygen consumption of rats and its changes with various experimental procedures. Appl Physiol 1979; 47: 1278-1283.

24. Subramanyam G, Bhaskar M, Govindappa S. The role of cadmium in induction of atherosclerosis in rabbits. Indian Heart J 1992; 44: 177-180.

25. Mlynek V, Skoczyńska A. The proinflammatory activity of cadmium. Postepy Hig Med Dosw 2005; 59: 1-8.

26. Yamaoka-Tojo M, Tojo T, Wakaume K. Circulating interleukin-18: a specific biomarker for atherosclerosis-prone patients with metabolic syndrome. Nutr Metab 2011;8: 45-52.

27. Robson-Ansley PJ, Blannin A, Gleeson M. Elevated plasma interleukin-6 levels in trained male triathletes following an acute period of intense interval training. Eur J Appl Physiol 2007; 99: 353-360.

28. Tofighee A, Khazaei H, Jalili A. Comparison of Effect of One Course of Intense Exercise (Wingate test) on Serum Levels of Interleukin-17 in Different Groups of Athletes. Asian J Sports Med 2014; 5: e22769.

29. Duzova H, Karakoc Y, Hanifi MT, Yilmaz ZD, Kilinc E. Effects of acute moderate and strenuous exercise bouts on IL-17 production and inflammatory response in trained rats. J Sport Sci Med 2009; 8: 219-224.

30. Daryanoosh F, Jafari H, Rahimi E, Mehrbani D, Soltani F. The effect of eight week interval acute training on plasma visfatin, TNF-α and IL-6 in rats: a brief report. Tehran Univ Med J. 2013; 71 :603-608.

31. Mirdar S, Arab A, Hedayati M, Hajizadeh A. The effect of a course of swimming training program on the levels of lung hypoxia induced invasion of newborns in pregnant rats. Qom Univ Med Sci J 2013; 7: 11-20.

32. Leggate M, Carter WG, Evans JC, Vennard RA, Nimmo MA. Determination of inflammatory and prominent proteomic changes in plasma and adipose tissue after high-intensity intermittent training in overweight and obese males. J Appl Physiol 2012; 112: 1353-1360.

33. Nikseresht M, Agha-Alinejad H Azarbayjani M A, Ebrahim K. Effects of Nonlinear Resistance and Aerobic Interval Training on Cytokines and Insulin Resistance in Sedentary Men Who Are Obese. J Strength Condition Res 2014; 28: 2560-2568.

34. Steckling FM, Farinha JB, Santos DL, Bresciani G, Mortari JA, Stefanello ST, et al. High intensity interval training reduces the levels of serum inflammatory cytokine on women with metabolic syndrome. Exp Clin Endocrinol Diabetes 2016; 124: 597-601.

35. Leggate M, Carter WG, Evans JC, Vennard RA, Nimmo MA. Determination of inflammatory and prominent proteomic changes in plasma and adipose tissue after high-intensity intermittent training in overweight and obese males. J Appl Physiol 2012; 112: 1353-1360.

36. Rosendal L, Sogaard K, Kjaer M, Sjogaard G, Langberg H, Kristiansen J. Increase in interstitial interleukin-6 of human skeletal muscle with repetitive low-force exercise. J Appl Physiol 2005; 98: 477-481.

37. Gibala MJ, Little JP, van Essen M. Short-term sprint interval versus traditional endurance training: similar initial adaptations in human skeletal muscle and exercise performance. J Physiol 2006, 575: 901-911.