Correlation Effects of Nano Selenium and Conjugated Linoleic Acid on the Performance, Lipid Metabolism and Immune System of Male Moghani Lambs

Iranian Journal of Applied Animal Science

مقاله 9، دوره 9، شماره 3، آذر 2019، صفحه 443-451   

نویسندگان

S. Ghaderzadeh؛ F. Mirzaei Aghjegheshlagh^* ؛ S. Nikbin؛ B. Navidshad

Department of Animal Science, Faculty of Agriculture and Natural Resources, University of Mohaghegh Ardabili, Ardabil, Iran

چکیده

This study was carried out to evaluate the effects of nano selenium (nano-Se) and conjugated linoleic acid (CLA) on performance, biometric and blood parametersand selenoprotein W1 (SEPW1) and lipid gene expression in male Moghani lambs. Thirty male Moghani lambs, 3-months-old and weighing 30 ± 0.25 kg, were used in completely randomized design in a 2 × 3 factorial arrangement with dietary supplemental the CLA (0 and 15 g/kg DM) and nano-Se (0, 1 and 2 mg/kg DM). The lambs were slaughtered on day 90 (end of experiment). Feeding a mixture of CLA and nano-Se tended to reduce the body weight of lambs comparing to the control group. The experimental diets had no impact on biometric parameters. Some blood parameters like high density lipoprotein (HDL), low density lipoprotein (LDL), thyroxine (T4), triiodothyronine (T3) and glutathione peroxidase (GPx) and glutathione peroxidase depended on dietary nano-Se supplementation (P<0.05); but glucose, triglycerides (TG), very low density lipoprotein (VLDL), total protein (TP) and cholesterol had no considerable effects. The results of qPCR analysis showed that nano-Se supplemental at highest level (2 mg/kg DM) increased gene expression of GPX1 and SEPW1 in liver (P<0.05). Dietary inclusion of CLA enhanced the peroxisome proliferator-activated receptor gamma expression and decreased stearoyl COA desaturase 1 genes in tail (P<0.01). In conclusion, nano-Se and CLA differently increased the gene expression in liver and tail and had good impacts on some blood parameters; suggesting that nano-Se and CLA have not synergism interaction in the above parameters.

کلیدواژه‌ها

conjugated linoleic acid؛ lambs؛ Moghani؛ nano selenium؛ performance

اصل مقاله

INTRODUCTION

Minerals are essential nutrients for all the species due to their role in preserving the health, growth, safety and reproduction (Zhan et al. 2014). Selenium, a trace mineral, has positive effects in livestock. National research council (NRC, 2007) have recommended 0.1 to 0.2 mg of selenium per kilogram of dry matter (DM) for growing lambs but later editions (NRC, 2007) recommended 0.22 to 0.44 mg/kg DM. Selenium also applied in the antioxidant system by participating in the structure of selenoproteins (Ponce et al. 2018). Selenoenzymes are the product of selenoproteins produced by cellular metabolism and peroxide radicals (Kieliszek et al. 2017). Glutathione peroxidase 1 (GPX1) contains the amino acid selenocysteine, which is used for specific function in body. The function of this enzyme is to reduce the intracellular hydrogen peroxide (Lubos et al. 2011). Selenoproteine W1 (SEPW1), another selenoproteins, which is like GPX1 and it plays main role in protecting cells from oxidative stress in the cellular defense system (Wang et al. 2010). It has been reported a positive correlation between SEPW1 expression and selenium concentration in spleen of rat and sheep, and vice versa (Li et al. 2011; Yu et al. 2011). Selenium supplemental could enhance the expression corresponding to selenium-related genes in muscle and lipid in adipose tissue (Pinto et al. 2012). Peroxisome proliferator-activated receptor gamma (PPARγ) produces bands with non-esterified fatty acids and long-chain unsaturated fatty acid and converts fat signals into transcriptional changes; affecting the metabolic processes such as synthesis, storage, transfer and oxidation of fats (Tan et al. 2008; Malapaka et al. 2012). It has been found that the profile of dietary fatty acids, especially unsaturated fatty acids, regulates PPARγ gene expression, it affects the differentiation of the adipocyte cells and the pathway of energy-related genes (Sato et al. 2004). Stearoyl COA desaturase 1 (SCD1) enzyme regulates liver lipogenesis and lipid oxidation (Mainieri et al. 2006). It was reported the different amounts for synthesis and contexture of saturated fatty acid to unsaturated in heifers and beef cattle is associated with the key enzyme responsible for this differences is SCD1 (Barton et al. 2011). Conjugated linoleic acid (CLA) is known as a position of geometric for linoleic acid with conjugated double bonds. It has positive impacts on animal models, such as reducing fat in milk and body (Harvatine et al. 2014). However, investigation have indicated that dietary inclusion of selenium increases polyunsaturated fatty acids particularly CLA in bull meat (Netto et al. 2014), meat and liver of sheep (Gabryszuk et al. 2007), cow's milk (Ran et al. 2010) and goat (Pechova et al. 2008). Payne et al. (2005), in a research on dietary CLA and selenium supplementation in rats, have seen less reduction in weight gain of rats fed CLA + selenium-supplemented diet than CLA alone. Moghani breed is fat-tailed sheep which is raised in Ardabil province located in the north-west of Iran. Regarding positive impacts of CLA in reducing fat and beneficial impacts of selenium on liver and fat metabolism, it hypothesized that dietary inclusion of nano-selenium (nano-Se) and CLA may have synergism interaction effect on performance and key genes expression associated with liver enzymes and lipid metabolism. Therefore, this research was performed to study the impacts of nano-Se and CLA on performance, biometric and blood parameters and expression of GPX1 and SEPW1 genes in the liver and PPARγ and SCD1 genes in the tail of male Moghani lambs.

 

MATERIALS AND METHODS

Animals and experimental procedure

Thirty male Moghani lambs, 3-months-old and body weight of 30 ± 0.25 kg, were assigned in a completely randomized design with a 2 × 3 factorial arrangement with dietary supplemental of CLA (0 and 15 g/kg DM) and nano-Se (0, 1 and 2 mg/kg DM). Animals were classified into 6 groups with 5 animals and experimental treatments were including 1) control; without nano-Se and CLA, 2) 1 mg nano-Se/kg DM, 3) 2 mg nano-Se/kg DM, 4) 15 g CLA/kg DM, 5) 15 g CLA + 1 mg nano-Se/kg DM, 6) 15 g CLA + 2 mg nano-Se/kg DM. The selenium (liquid) and CLA (powder) utilized in current research were purchased from the Pishgaman Nano Mavade Iranian and Golbar Navid Bahar company, respectively. All lambs were kept in individual pens (1 m×1.85 m) with wood shavings as bedding. The room temperature was controlled at 18 ˚C with 60 to 70% humidity. The lighting was scheduledfrom 7 am to 9 am. Lambs were fed the experimental diets (Table 1) twice (8 am and 7 pm) a day and had free access to water.

 

Slaughter and sampling

The lambs’ growth performance was measured monthly. On day 90, the animals were slaughtered at the slaughter house of Ardabil. The protocol for animal research was approved by the Ethics Committee of the University of Mohaghegh Ardabili (Ethics committee reference number: IR.ARUMS.REC.1395.46). Weights of head, feets, wool and skin, liver, heart, testicular, kidney, lungs, hot and cold carcass, neck, tail, ribs and thigh were calculated. Liver and tail tissue specimens were obtained and frozen directly in liquid nitrogen and kept at -80 ^°C to subsequent analysis. Two-hundred mg of liver and tail tissues was immediately collected in RNA-later Stabilization Reagent (Thermo Scientific, USA) and processed for storage at -80 ^°C, following the instructions of producer.

 

RNA isolation and cDNA synthesis

Total RNA was separated from liver and tail samples by the High Pure RNA Tissue Kit (Sinaclon, Cat. No: RN7713C/EX6101, USA) as recommended by instructions of producer. ND-1000 Nano Drop (NanoDrop Technologies, USA) spectrophotometer was used to assess qualitative and quantitative the separated RNA. Only specimens with RNA above 100 ng and absorbance ratios of A260/280 and A260/230 of about 1.9 were utilized for more analyses. The RNA was reverse transcribed into cDNA with the Transcription First Strand cDNA Synthesis Kit (Thermo Scientific, USA). Denaturing 1.0 μg of RNA was performed at temperature of 95 ˚C for 5 min in the existence of 50 μM Oligo (dT). The reverse-transcription mixture (20 μL in total volume) included of RNA (13 μL), reverse transcriptase buffer (4 μL), 10 mM Dntp (2 μL), protector RNase Inhibitor (40 U/μL) (0.5 μL), and reverse transcriptase (20 U/μL) (0.5 μL).

 

Table 1 Ingredients and chemical composition of the diet (DM basis)

 

¹ The basal diet containing 0.3 mg per kilogram selenium in base of dry matter (premix composition per kg).

 

The incubation of resulted solution was then performed in temperature of 50˚C for 60 min, next at 70 ˚C for 10 min, and lastly kept at -20 ˚C.

 

Primer design

Designing primers of gene expression was performed using Primer 3Plus (http://www.bioinformatics.nl/) based on GenBank Ovis Aries sequences and amplicon sequence complied with boundaries of exon-exon. The abundances of relative mRNA of genes were tested. Chosen targets were two selenoprotein genes (GPX1 and SEPW1) and two genes related with metabolism of lipid (PPARγ and SCD1). In order to evaluate the expression of studied genes, the following primers were used. The sequence of the Glutathione peroxidase 1 (GPX1) forward primer was (CCTGGTCGTACTCGGCTTC) and GPX1 reverse was (CCTTCTCGCCATTCACCTC). The sequence of the selnoproteine W1 (SEPW1) forward primer was (CTATGGCGCTTGAGGCTACA) and SEPW1 reverse was (TGGAGTGAACCAGCTTTCCC). The sequence for the peroxisome proliferator-activated receptor gamma (PPARγ) forward primer was (ATGGCTTCATAACCCGTGAG) and PPARγ reverse was (AATCCCCTCCTGCATTTTCT). The sequence for the stearoyl COA desaturase (SCD1) forward primer was (GTGCCGTGGTATCTATGGGG) and SCD1 reverse was (GGGGTTGATGGTCTTGTCGT) and the sequence for the Beta-actin (ACTB) as the housekeeping gene forward primer was (CTCTTCCAGCCTTCCTTCCT) and ACTB reverse was (GCAGAAAGAGATCACTGCCC). The PCR fragment length for GPX1, SEPW1, PPARγ, SCD1 and ACTB genes were 154, 152, 206, 150 and 178 bp, respectively.

 

Quantitative real-time PCR assays (qPCR)

The PCR was performed in a total of 10 μL PCR mixture containing SYBR Green PCR Master Mix. Each reaction was run in triplicate and the average was utilized to compute the relative value of the target gene. Housekeeping gene ACTB, stability was examined by geNorm software version 3.4., which calculates the measure of gene expression constancy corresponding to a putative reference gene on the basis of the average pairwise variation between all investigated reference gene. The relative gene expression was normalized against a factor which was on the basis of the geometric average of the expression level corresponding to the housekeeping gene, based on the recommendation of Vandesompele et al. (2002). For calculating the relative genes expression, the ΔCt and ΔΔCt formula was used the (Livak and Schmittgen, 2001).

 

Blood parameters

On day 90 of experiment, before slaughter blood samples (10 mL) were collected from each lamb and centrifuged at 2500 rpm for 15 min and kept at -20 ˚C until subsequent analyses. The blood specimens were tested for high density lipoprotein (HDL), low density lipoprotein (LDL), thyroxine (T4), triiodothyronine (T3), glutathione peroxidase (GPx), triglycerides (TG), total protein (TP) glucose, triglycerides (TG), very low density lipoprotein (VLDL), total protein (TP) and cholesterol by using Pars Azmoon commercial kits (Karaj, Iran).

 

Statistical analysis

Effects of CLA and nano-Se and their interactions were evaluated by analysis of variance by the command PROC GLM of SAS (2003) software based on the model:

Yi= μ + Ti + Sj + TSij + eijk

Where:

Yi: dependent variable.

μ: overall average.

Ti: effect of CLA.

Sj: impact of selenium.

eijk: residual error.

The effects of treatment based on the diet were determined with averages calculated by command LSMEANS and Duncan test was utilized for determination of the considerable differences amongst the treatment groups at significant level of P < 0.05.

 

RESULTS AND DISCUSSION

Our findings in Table 2 showed that addition of selenium and CLA in the amounts mentioned had no considerable impact on mean daily gain, final weight, feed intake and feed conversion ratio (P<0.05). Parallel to current results, Vignola et al. (2009) did not observe the significant difference in weight gain, feed intake and feed conversion ratio in animals receiving the diverse levels of selenium. Other investigations have indicated that dietary inclusion of 1 and 2 ppm of nano-selenium in the diet did not impact on growth rate and feed conversion ratio (Kumar et al. 2008). It has been found that dietary inclusion of selenium increased gaining weight and in taking feed in goat (Shi et al. 2011). The conflicts in earlier investigations may be described by amount and kind of basal diet and diverse kinds of selenium in the diet. Other investigations have indicated that dietary inclusion corresponding to selenium and CLA had not important impact on growth efficiency (Vignola et al. 2009; Kumar et al. 2008). Payne et al. (2005) reported that dietary inclusion of CLA in the existence of selenium in the rat’s diet, caused to reduction of the weight gain comparing with those only treated with CLA. It can be stated that selenium and CLA have not important influence on performance which is able to be attributed concentrations of selenium and CLA which could be insufficient for affecting on performance. Effects of treatments on biometric and abattoir parameters are presented in Table 3. As results show the divers amounts of nano selenium and CLA had no important influence on these parameters. In support of these results, other investigations did not report significant effects of CLA and selenium on such parameters (Lambertini et al. 2005; Vignola et al. 2009; Schiavon et al. 2010). We did not see a positive correlation between carcass characteristics and growth performance. The influence of treatments on blood metabolites is presented in Table 4. Results indicated that nano selenium in singly form had significant effects on HDL, LDL, T3, T4 and GPx (P< 0.05), but it had not important influence on glucose, VLDL, TG and cholesterol. It has been found that mice with selenium deficiency showed increased plasma cholesterol and the usage of appropriate amounts can cause a reduction in LDL and rise in HDL (Qu et al. 2000). Serum cholesterol is transformed in the HDL fraction and is considered as index for lipoprotein concentrations (Herdt and Smith, 1996). The liver has low capacity for synthesizing cholesterol in ruminants; cholesterol is synthesized in adipose tissue and small intestine (Liepa et al. 1978; Chen et al. 1995). Partly similar to our results, other investigations have reported that dietary inclusion of selenium caused to decrease T4 hormone and increase T3 hormone (Wichtel et al. 1996). Dalir-Naghadeh and Rezaei (2008) reported that concentrations of serum and T3 and ratio of T3 to T4 in muscle disease in lambs was less than healthy lambs. Nano-selenium supplementation to the diet increased GPx (P<0.0001). The activity of enzyme is taken into account as an important indicator of selenium status in animals (Yang et al. 1989). Kumar et al. (2008) indicated that addition of 0.15 ppm selenium in basal diet containing 0.19 ppm selenium increased glutathione peroxidase function in erythrocytes. The function of GPxs is to decrease hydrogen peroxides and lipid hydroperoxides. Since selenium is a glutathione peroxidase component and a direct linear relationship is between blood selenium status and function of this enzyme this result is logical (Yang et al. 1989). Furthermore, the data corresponding to GPX1 expression confirmed our findings for serum. It can be concluded that selenium participates in GPX1 structure and prevented lipid peroxidation and thus improves blood parameters. This study tried to include the highest amounts of selenium on Moghani male lambs (2 mg/kg DM) in nano form. The results of qPCR analysis showed that nano-Se differently improved the genes expression.

 

Table 2 The effects of treatments on the performance (n=5)¹

 

¹ Conjugated linoleic acid (CLA) levels (0 and 15 g kg dry matter), nano-selenium levels (0, 1 and 2 mg per kilogram of dry matter).

FI: feed intake (grams per day); LW: live weight (kg); ADG: average daily gain (g) and FCR: feed conversion ratio.

SEM: standard error of the means.

NS: non significant.

 

Table 3 The effects of treatments on biometric parameters and carcass characteristics (n=5)¹

 

¹ Conjugated linoleic acid (CLA) levels (0 and 15 g kg dry matter), nano-selenium levels (0, 1 and 2 mg per kilogram of dry matter).

SEM: standard error of the means.

NS: non significant.

 

Nano-Se increased the expression of GPX1 and SEPW 1 in liver (P<0.05) but it had not important influence on PPARγ and SCD1 (P<0.05) (Figure 1). Conversely, CLA did not have important influence on the expression of GPX1 and SEPW 1 in liver (P<0.05) but its impacts on PPARγ and SCD1 was significant (P<0.01). Many studies have reported dietary inclusion of selenium increased the expression of GPX1 and SEPW1 (Sunde, 2017; Yu et al. 2011), which is in accordance with our findings. On the other hand, other investigations have reported that the types and amounts of selenium did not improve the levels of selenoproteins enzymes and some genes including GPX1 and SEPW1 (Elsom et al. 2006; Zhou et al. 2009). Conversely, Liu et al. (2012) stated that selenium supplemental at high levels (3.0 mg Se/kg) reduced SEPW1 mRNA amount in the pigs liver comparing to other levels (0.3 mg Se/kg diet). The enhanced in GPX1 can show to increase the health in animals, because it inhibits oxidation. Antioxidants including GPX1 and SEPW1 are synthesized within the cells and play role as primary defense system against free radicals (Sunde,2017). The GPX1 and SEPW can reduce free radical production.

 

Table 4 The effects of treatments on blood metabolites (n=5)

 

HDL: high density lipoprotein; LDL: low density lipoprotein; VLDL: very low density lipoprotein; TG: triglycerides; T3: triiodothyronine; T4: thyroxine; TP: total protein and GPx: glutathione peroxidase.

The means within the same row with at least one common letter, do not have significant difference (P>0.05).

SEM: standard error of the means.

NS: non significant.

 

Figure 1 The effects of treatments on the expression of the desired genes

C: Control; S-1: Se 1 mg/kg DM; S-2: Se 2 1 mg/kg DM; CL: CLA (conjugated linoleic acid); CLS-1: 15 mg/kg DM CLA + 1 mg/kg DM Se and CLS-2: 15 mg/kg DM CLA + 2 mg/kg DM Se

GPX1: glutathione peroxidase 1; SEPW1: selenoprotein W1; PPARγ: peroxisome proliferator-activated receptor gamma and SCD1: stearoyl COA desaturase 1

Values are shown as mean ± SEM (n=5)

Columns with dissimilar letters indicate significant difference

* (P≤0.05) and ** (P<0.01)

NS: non significant

 

As has been previously reported, extensive oxidation increases the synthesis of unstable compounds known as free radicals (Levander O.A. and Beck, 1997), which would damage the biological components in the body and cause peroxidation of lipid, protein carboxylation and DNA strand breakages, ultimately causing various clinical consequences (Stone et al. 2010). Previous studies have been reported that some antioxidants such as vitamins and selenium are a secondary defense system (Ghaderzadeh et al. 2016). Our results confirm the selenium role in these metabolic mechanism; suggesting that selenium is not only a key antioxidant but also a gene expression regulator. CLA increased the expression corresponding to PPARγ and decrease the SCD1 genes. PPAR is active group of protein nuclear receptors that interfere with regulating the genes expression which affect energy metabolism, differentiation of cell, and death of cell, and plays main role in cellular differentiation, development and lipid, carbohydrates and proteins metabolism of the animals. PPARγ is the key regulator corresponding the fat cells differentiation and production, and has a key role in controlling the overall metabolism of the body and is mainly expressed in fat tissues (Spiegelman, 1998). CLA is considered as agonist component for PPARγ. PPARγ isoforms are part of the regulatory impacts of dietary fatty acids on gene expression and interferes in the fat storage and is observed to be great in adipose tissue. According to the outcomes of current research, CLA enhanced expression of PPARγ gene in fat tissue (Heikkinen et al. 2007). It can be stated a direct relationship presence of CLA in the diet and the amount of PPARγ gene expression, which will enhance the meat quality and change the profile of the adipose tissue. Other gene is SCD1 which plays main role in adding a double bond in the Delta 9 position in an extensive range of fatty acids that, leading to produce CLA in ruminants’ meat and milk (Corl et al. 2001; Ntambi et al. 2002). SCD1 was the one of the first candidate genes to attract researchers to change the ratio of saturated to unsaturated fatty acids and increase the level of conjugated linoleic acids in milk (Medrano et al. 2007). The function of this SCD1 reduces with the existence of unsaturated fatty acids in the diet and increases with their absence because of the existence of CLA in the diet (P<0.001). It means that altering the diet can impact the function of genes that consequently changes the quality of animal products. Based on our findings, there was no synergism interaction effect was observed between selenium and CLA, which can be explained by presence of selenium in the diet, may cause the unsaturated fatty acids oxidation and affect the level of genes expression (Lawler et al. 2004). Furthermore, high amounts of selenium in the diet can damage the liver and consequently affect the metabolism corresponding to fatty acids and selenium  (Galan-Cjllet et al. 2015). Wang et al. (2014) reported that high levels of selenium could disrupt liver function and, consequently, impair the metabolism corresponding to fats, which concluded that high amounts of selenium may rise oxidative stress.

 

CONCLUSION

The outcomes of current research presented that nano-Se and CLA differently had improtant impacts on the expression of GPX1, SEPW1 and PPARβ1 and SCD1 genes and also some blood parameters. It means that nutrition can have significant role in changing the expression of gene which influences the amount of the products derived from ruminants through nutrition. Though, in current research, the synergism interaction between selenium and conjugated linoleic acid was not found and further research is needed.

 

ACKNOWLEDGEMENT

The authors would like to appreciate and gratitude to all those from the Department of Animal Science the Mohaghegh Ardabili University and Golbar Navide Bahar for preparing the CLA.

مراجع

Bartoň L., Bureš D., Kott T. and Řehák D. (2011). Effect of sex and age on bovine muscle and adipose fatty acid composition and stearoyl-CoA desaturase mRNA expression. Meat Sci. 89, 444-450.

Chen Z., Herdt T.H., Liesman J.S., Ames N.K. and Emery R.S. (1995). Reduction of bovine plasma cholesterol concentration by partial interruption of enterohepatic circulation of bile salts: a novel hypocholesterolemic model. J. Lipid Res. 36, 1544-1556.

Corl B.A., Baumgard L.H., Dwyer D.A., Griinari J.M., Phillips B.S. and Bauman D.E. (2001). The role of Δ9-desaturase in the production of cis-9, trans-11 CLA. J. Nutr. Biochem. 12, 622-630.

Dalir-Naghadeh B. and Rezaei S.A. (2008). Assessment of serum thyroid hormone concentrations in lambs with selenium deficiency myopathy. Am. J. Vet. Res. 69, 659-663.

Elsom R., Sanderson P., Hesketh J.E., Jackson M.J., Fairweather-Tait S.J., Åkesson B. and Arthur J.R. (2006). Functional markers of selenium status: UK Food Standards Agency workshop report. British J. Nutr. 96, 980-984.

Gabryszuk M., Czauderna A.B., Strzałkowska N. and Jóźwik J.K. (2007). The effect of diet supplementation with Se, Zn and vitamin E on cholesterol, CLA and fatty acid. Anim. Sci. Pap. Rep. 25, 25-33.

Galan-Chilet I., Guallar E., Martin-Escudero J.C., De Marco G., Dominguez-Lucas A., Gonzalez-Manzano I., Lopez-Izquierdo R., Redon J., Chaves F.J. and Tellez-Plaza M. (2015). Do genes modify the association of selenium and lipid levels? Antioxid. Redox. Sign. 22, 1352-1362.

Ghaderzadeh S., Mirzaei Aghjeh-Gheshlagh F., Nikbin S. and Navidshad B. (2016). Review on properties of selenium in animal nNutrition. Iranian J. Appl. Anim. Sci. 6, 753-761.

Harvatine K.J., Robblee M.M., Thorn S.R., Boisclair Y.R. and Bauman D.E. (2014). Trans-10, cis-12 CLA dose-dependently inhibits milk fat synthesis without disruption of lactation in C57BL/6J Mice–4. J. Nutr. 144, 1928-1934.

Heikkinen S., Auwerx J. and Argmann C.A. (2007). PPARγ in human and mouse physiology. Biochim. Biophys. Acta. 1771, 999-1013.

Herdt T.H. and Smith J.C. (1996). Blood-lipid and lactation-stage factors affecting serum vitamin E concentrations and vitamin E cholesterol ratios in dairy cattle. J. Vet. Diagn. Invest. 8, 228-232.

Kieliszek M., Lipinski B. and Błażejak S. (2017). Application of sodium selenite in the prevention and treatment of cancers. Cells. 6(4), 39-48.

Kumar N., Garg A.K., Mudgal V., Dass R.S., Chaturvedi V.K. and Varshney V.P. (2008). Effect of different levels of selenium supplementation on growth rate, nutrient utilization, blood metabolic profile, and immune response in lambs. Biol. Trace. Elem. Res. 126, 44-56.

Lambertini L., Morittu V.M., Vignola G., Zaghini G. and Formigoni A. (2005). Study on production of light lambs reared in Abruzzo region by traditional way: First results. Proc. SIS. Vet. 59, 449-450.

Lawler T.L., Taylor J.B., Finley J.W. and Caton J.S. (2004). Effect of supranutritional and organically bound selenium on performance, carcass characteristics, and selenium distribution in finishing beef steers 1. J. Anim. Sci. 82, 1488-1493.

Levander O.A. and Beck M.A. (1997). Interacting nutritional and infectious etiologies of Keshan disease. Biol. Trace. Elem. Res. 56, 5-21.

Li J.L., Li H.X., Li S., Jiang Z.H., Xu S.W. and Tang Z.X. (2011). Selenoprotein W gene expression in the gastrointestinal tract of chicken is affected by dietary selenium. Biometals. 24, 291-299.

Liepa G.U., Beitz D.C. and Linder J.R. (1978). Cholesterol synthesis in ruminating and nonruminating goats. J. Nutr. 108, 535-543.

Liu Y., Zhao H., Zhang Q., Tang J., Li K., Xia X.J. and Lei X.G. (2012). Prolonged dietary selenium deficiency or excess does not globally affect selenoprotein gene expression and / or protein production in various tissues of pigs–3. J. Nutr. 142, 1410-1416.

Livak K.J. and Schmittgen T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 25, 402-408.

Lubos E., Loscalzo J. and Handy D.E. (2011). Glutathione peroxidase-1 in health and disease: From molecular mechanisms to therapeutic opportunities. Antioxid. Redox. Signal. 15, 1957-1997.

Mainieri D., Summermatter S., Seydoux J., Montani J.P., Rusconi S., Russell A.P. and Summermatter S. (2006). A role for skeletal muscle stearoyl-CoA desaturase 1 in control of thermogenesis. FASEB J. 20, 1751-1753.

Malapaka R.R., Khoo S., Zhang J., Choi J.H., Zhou X.E., Xu Y. and Chang L. (2012). Identification and mechanism of 10-carbon fatty acid as modulating ligand of peroxisome proliferator-activated receptors. J. Biol. Chem. 287, 183-195.

Medrano J.F., Islas-Trejo A.D., Johnson A.M. and De Peters E.J. (2007). Genomic structure and expression of the bovine stearoyl-CoA desaturase gene. http://www.ncbi.nlm.nih.gov/Genbank/index.html. AccessedSep. 2006.

Netto A.S., Zanetti M.A., Del Claro G.R., de Melo M.P., Vilela F.G. and Correa L.B. (2014). Effects of copper and selenium supplementation on performance and lipid metabolism in confined brangus bulls. Asian-Australasian J. Anim. 27, 488-494.

NRC. (2007). Nutrient Requirements of Small Ruminants, Sheep, Goats, Cervids, and New World Camelids. National Academy Press, Washington, D.C., USA.

Ntambi J.M., Miyazaki M., Stoehr J.P., Lan H., Kendziorski C.M., Yandell B.S. and Attie A.D. (2002). Loss of stearoyl–CoA desaturase-1 function protects mice against adiposity. Proc. Natl. Acad. Sci. 99, 11482-11486.

Payne R.L., Lavergne T.K. and Southern L.L. (2005). Effect of inorganic versus organic selenium on hen production and egg selenium concentration. Poult. Sci. 84, 232-237.

Pechova A., Misurova L., Pavlata L. and Dvorak R. (2008). Monitoring of changes in selenium concentration in goat milk during short-term supplementation of various forms of selenium. Biol. Trace. Elem. Res. 121, 180-191.

Pinto A., Juniper D.T., Sanil M., Morgan L., Clark L., Sies H. and Steinbrenner H. (2012). Supranutritional selenium induces alterations in molecular targets related to energy metabolism in skeletal muscle and visceral adipose tissue of pigs. J. Inorg. Biochem. 114, 47-54.

Ponce M., Giraldez I., Calero S., Ruiz-Azcona P., Morales E., Fernández-Díaz C. and Hachero-Cruzado I. (2018). Toxicity and biochemical transformation of selenium species in rotifer (Brachionus plicatilis) enrichments. Aquaculture. 484, 105-111.

Qu X., Huang K., Deng L. and Xu H. (2000). Selenium deficiency-induced alterations in the vascular system of the rat. Biol. Trace. Elem. Res. 75, 119-128.

Ran L., Wu X., Shen X., Zhang K., Ren F. and Huang K. (2010). Effects of selenium form on blood and milk selenium concentrations, milk component and milk fatty acid composition in dairy cows. J. Sci. Food Agric. 90, 2214-2219.

SAS Institute. (2003). SAS^®/STAT Software, Release 9.1. SAS Institute, Inc., Cary, NC. USA.

Sato K., Fukao K., Seki Y. and Akiba Y. (2004). Expression of the chicken peroxisome proliferator-activated receptor-γ gene is influenced by aging, nutrition, and agonist administration. Poult. Sci. 83, 1342-1347.

Schiavon S., Tagliapietra F., Dal Maso M., Bailoni L. and Bittante G. (2010). Effects of low-protein diets and rumen-protected conjugated linoleic acid on production and carcass traits of growing double-muscled Piemontese bulls 1. J. Anim. Sci. 88, 3372-3383.

Shi L., Xun W., Yue W., Zhang C., Ren Y., Shi L. and Lei F. (2011). Effect of sodium selenite, Se-yeast and nano-elemental selenium on growth performance, Se concentration and antioxidant status in growing male goats. Small Rumin. Res. 96, 49-52.

Spiegelman B.M. (1998). PPAR-gamma: Adipogenic regulator and thiazolidinedione receptor. Diabetes. 47, 507-514.

Stone C.A., Kawai K., Kupka R. and Fawzi W.W. (2010). Role of selenium in HIV infection. Nutr. Rev. 68, 671-681.

Sunde R.A. (2017). Effects of initial selenium status on apparent dietary selenium requirements in rodents. FASEB J. 31, 802-321.

Tan G.D., Savage D.B., Fielding B.A., Collins J., Hodson L., Humphreys S.M. and Karpe F. (2008). Fatty acid metabolism in patients with PPARγ mutations. J. Clin. Endocrinol. Metab. 93, 4462-4470.

Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A. and Speleman F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3(7), 34-41.

Vignola G., Lambertini L., Mazzone G., Giammarco M., Tassinari M., Martelli G. and Bertin G. (2009). Effects of selenium source and level of supplementation on the performance and meat quality of lambs. Meat Sci. 81, 678-685.

Wang X., Zhang W., Chen H., Liao N., Wang Z., Zhang X. and Hai C. (2014). High selenium impairs hepatic insulin sensitivity through opposite regulation of ROS. Toxicol. Lett. 224, 16-23.

Wang X.L., Yang C.P., Xu K. and Qin O.J. (2010). Selenoprotein W depletion in vitro might indicate that its main function is not as an antioxidative enzyme. Biochem (Moscow). 75, 201-207.

Wichtel J.J., Craigie A.L., Freeman D.A., Varela-Alvarez H. and Williamson N.B. (1996). Effect of selenium and iodine supplementation on growth rate and on thyroid and somatotropic function in dairy calves at pasture. J. Dairy Sci. 79, 1865-1872.

Yang J.G., Hill K.E. and Burk R.F. (1989). Dietary selenium intake controls rat plasma selenoprotein P concentration. J. Nutr. 119, 1010-1012.

Yu D., Li J.L., Zhang J.L., Gao X.J. and Xu S. (2011). Effects of dietary selenium on selenoprotein W gene expression in the chicken immune organs. Biol. Trace. Elem. Res. 144, 678-687.

Zhan X., Wang H., Yuan D., Wang Y. and Zhu F. (2014). Comparison of different forms of dietary selenium supplementation on gene expression of cytoplasmic thioredoxin reductase, selenoprotein P, and selenoprotein W in broilers. Czech. J. Anim. Sci. 59, 571-578.

Zhou J.C., Zhao H., Li J.G., Xia X.J., Wang K.N., Zhang Y.J. and Lei X.G. (2009). Selenoprotein gene expression in thyroid and pituitary of young pigs is not affected by dietary selenium deficiency or excess. J. Nutr. 139, 1061-1066.