The Effect of SNP c.100800G > A on CAST|Cfr13I Gene Polymorphisms with Ultrasound Imaging of Meat Characteristics and Growth Traits in Bali Cattle

Iranian Journal of Applied Animal Science

دوره 11، شماره 4، اسفند 2021، صفحه 707-715   

نویسندگان

N.M.P. Setyani؛ R. Priyanto؛ J. Jakaria^*

Department of Animal Production and Technology, Faculty of Animal Science, Bogor Agricultural University, Bogor, Indonesia

چکیده

Bali cattle are known as native cattle from Indonesia, which commonly utilized as beef-producing animals. Calpastatin gene (CAST) plays essential role in meat quality. The aim of this study was to verify the effect of single-nucleotide polymorphism (SNP) c.100800G>A on the CAST|Cfr13I gene associated with meat characteristics and growth traits in Bali cattle. The meat characteristics, growth traits profile, and blood samples of Bali cattle (n=52 animals) obtained from BPTU Bali Cattle Denpasar, Bali Province. Comparison used were Belgian Blue (n=30 animals), Wagyu (n=7 animals), Limousin (n=14 animals), and Peranakan Onggole (PO) (n=30 animals). Ultrasound measurement was conducted to study the meat characteristics. The examination of the CAST gene polymorphisms used polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method digested by Cfr13I enzyme and the analysis of effect of the CAST|Cfr131 gene on meat characteristics and growth traits in Bali cattle used t test with SAS 9.4 program. Bali cattle revealed polymorphic homozygous genotype (GG) and heterozygous genotype (GA) with allele frequencies of G and A were 0.923 and 0.077, respectively. In comparison, other breeds beef cattle, including Belgian Blue, Limousin, Wagyu, and PO, showed only the GG genotype with allele frequency of G was 1.000. The CAST|Cfr13I gene showed no significant association (P>0.05) with Bali cattle meat characteristics and growth traits. In conclusion, the SNP c.100800G > A may not be purposed as a marker for Bali cattle meat characteristics and growth traits. It was suggested that further study with a higher number of animals would be necessary to validate the effect of the SNP c.100800G > A on the CAST gene with the actual beef cutting of Bali cattle.

کلیدواژه‌ها

Bali cattle؛ CAST gene؛ growth traits؛ meat characteristics؛ PCR-RFLP؛ ultra-sound

اصل مقاله

INTRODUCTION

Bali cattle is one of the Indonesian native cattle (Purwantara et al. 2012). Bali cattle has been registered by the Ministry of Agriculture of the Republic of Indonesia (325/Kpts/OT.140/1/2010) as a native Indonesian cattle. Analysis of the MtDNA D-loop gene also showed that Bali cattle have very close relatives with banteng, however, not with Bos taurus and Bos indicus (Wisesa et al. 2012). The use of Bali cattle as beef cattle still need to increase meat production and meat quality. This due to its adaptation to extreme condition (Purwantara et al. 2012). Therefore, Bali cattle is appropriate for environmental condition in Indonesia. Reproduction of Bali cattle is remarkable, in which the service/conception and birth rates of Bali cattle were 95.62% and 86.25%, respectively (Wawo, 2018). Suryanto et al. (2014) reported that the rib eye area (REA) of Bali cattle was 59.65 ± 0.64 cm², backfat thickness (BFT) was 3.08 ± 0.28 mm, and the marbling score (MS) was 2.65 ± 0.92%. Setiaji et al. (2019) also described that the birth weight (BW) of Bali cattle was 17.94 ± 1.95 kg, weaning weight (WW) 82.52 ± 15.24 kg, and yearling weight (YW) 122.46 ± 18.29 kg. Many factors affect meat quality, i.e. gender, age, feed, breeds, housing system, pre-slaughter treatment, and genetics (Raza et al. 2019). Gen CAPN, CAST, COL1A1, and ASAP1 were reported to associate with meat quality in Nellore cattle using the GWAS Illumina BovineHD Beadchip technique (Tizioto et al. 2013). Calpastatin (CAST) is one of the genes that has essential role in meat quality in swine (Krzęcio et al. 2008); poultry (Ghamari Monavvar et al. 2020); cattle (Jr et al. 2018; Raza et al. 2019). The CAST was identified in muscle tissue as a µ-calpain inhibitor (Busch et al. 1972) and had an important role in the meat tenderization process (Pinto et al. 2010). The CAST gene is located on chromosome 7 in cattle (Kappes et al. 1997), which consists of 35 exons and 34 introns (Raynaud et al. 2005). The CAST gene also contributes in the postmortem proteolysis (Calvo et al. 2014). The higher CAST activity (before and after rigor mortis) lowering the number of myofibrillar protein postmortem proteolysis (Guimarães et al. 2019), which causes the meat to become tougher. The CAST also influences in gene expression during cell development (Van Ba et al. 2014). Furthermore, the calpain/calpastatin system regulates muscle cell migration and cell differentiation in the early stages of development (Dedieu et al. 2004; Moyen et al. 2004; Barnoy et al. 2005). Several reports showed that the CAST gene is also associated with birth weight (BW) and weaning weight (WW) in Argentine Angus cattle (Pintos and Corva, 2011). Studies regarding to the polymorphisms of the CAST gene still need to be carried out in confirming the association between the CAST gene and meat characteristics and growth traits. Some of the methods commonly used in DNA level studies are Restriction Fragment Length Polymorphisms (RFLPs), Amplified Fragment Length Polymorphisms (AFLPs), Random Amplified Polymorphic DNA (RAPD), Real-time PCR, Sequencing, and DNA microarrays (Pereira et al. 2008). The PCR-RFLP is a method used to examine genetic diversity between species using restriction enzymes (Sun and Lin, 2003). The PCR-RFLP method is efficient, especially for specific loci (Hashim and Al-Shuhaib, 2019). Pratiwi (2016) reported 25 SNPs on the CAST gene, which were polymorphic in Bali cattle using the direct sequencing method. Among the SNPs is c.100800G > A significantly affected the rump thickness with a limited population. There is still lack study of the SNP c.100800G > A on several beef cattle breeds. Based on these rationales, this study was conducted to identify and analyze the diversity of SNP c.100800G > A on the CAST

gene using PCR-RFLP measure on several beef cattle breeds and its association with meat characteristics and growth traits.

 

MATERIALS AND METHODS

Animal and traits evaluated

Blood samples from 133 several breeds of beef cattle were used in this study. T including Bali cattle (n=52) blood samples were obtained from BPTU-HPT Bali Cattle Denpasar, Bali Province, Belgian Blue (n=30), Wagyu (n=7), Peranakan Onggole (PO) (n=30), Limousin (n=14) blood samples were used as comparisons. About 300 μL of the blood samples were extracted by standard method from Geneaid^TM DNA Isolation Kit Ver. 02.21.17. The meat characteristic traits in Bali cattle, including backfat thickness (BFT), longissimus dorsi thickness (LDT), percentage of intramuscular fat/IMF (PIMF), and marbling score (MS) were measured by ultrasound imaging method (Veterinary Ultrasound Scanner WED-3000V models) at the 12^th-13^th ribs position (Melendez and Marchello, 2014). The USG results were examined using Image-J NIH software (ImageJ®, NIH, USA). To determine the MS is based on AUSTRALIAN MEAT and MSA (http://www.wagyu.org.au/marbling/). The growth traits in Bali cattle were figured by birth weight (BW), weaning weight (WW), yearling weight (YW), two years weight (TYW), and daily gain weight (DGW).

 

PCR Amplification and gene polymorphism

The fragment CAST gene was amplified using specifics primer (Palmer et al. 1998; Putri et al. 2015) (GenBank: AF117813.1) exon 15 and 16, forward: 5’TGGGGCCCAATGACGCCATCGATG’3 and reverse: 5’GGTGGAGCAGCACTTCTGA TCACC’3. The amplification of CAST gene fragment was performed in PCR Thermal Cycler-ESCO with the following protocol: the pre-denaturation temperature at 95 ˚C for 1 min, followed by 35 cycles of denaturation at 95 ˚C for15 s, annealing at 60 ˚C for15 s, extension at 72 ˚C for 10 s, and the final extension was at 72 ˚C 5 min. Amplification was examined on horizontal electrophoresis (100 volts for 40 min) in 1.5% agarose gel and visualized by UV transilluminator (Biorad^TM, California, USA). The 624 bp CAST gene was digested by Cfr13I restriction enzyme, which has 5'-G|GNCC-'3 digestion site (https://nc2.neb.com/NEBcutter2/). The re­action mixture was incubated at 37 ˚C for 4 h. The digestion products were examined by horizontal electrophoresis (100 volts for 40 min) in 2% agarose gel and visualized by UV transilluminator (Biorad^TM, California, USA).

 

Data analysis

The allelic (X_i) and genotypic (X_ii) were calculated according to Moonesinghe et al. (2010) by using Pop-gen 1.32 program. The mathematical model as follow:

X_i= (N_ii+Sn_ij) / 2N

X_ii= n_ii / n

Where:

X_i: allelic frequency of G and A.

X_ii: genotype frequency GG and GA.

n_ii: number of individual of GG genotype.

n_ij: number of individual of GA genotype.

N: total of individual samples.

The observed heterozygosity (H_o) and expected heterozygosity (H_e) calculated using the method of Moonesinghe et al. (2010) using the PopGen 1.32 program. The mathematical model as follow:

Where:

H_o: observed heterozygosity.

H_e: expected heterozygosity.

n_ij: number of heterozygous individuals.

N: total sample.

X_i: frequency of the i allele.

Q: number of the allele.

Chi-Square was used to test the Hardy-Weinberg balance (Moonesinghe et al. 2010) by using Pop-gen 1.32 program. The mathematical formula as follows:

Where:

X²: chi-square.

O: observed value.

E: expected value.

The association between CAST|Cfr13I gene with meat characteristics (backfat thickness/BFT, longissimus dorsi thickness/LDT, percentage of intramuscular fat/PIMF, and marbling score/MS) and growth traits (birth weight/BW, weaning weight/WW, yearling weight/YW, two years weight/TYW and daily gain weight/DGW) were analyzed by using t test (Kim, 2015) with SAS 9.4. program (SAS, 2004). The mathematical model as follow:

Where:

: mean meat characteristics/growth traits of the GG genotype.

: mean meat characteristics/growth traits of the GA genotype.

n₁: number of individual with GG genotype.

n₂: number of individual with GA genotype.

s: variety.

 

RESULTS AND DISCUSSION

The CAST gene was successfully amplified on exon 15 to exon 16 with fragment size 624 bp on annealing temperature of 60 ˚C (Palmer et al. 1998); (Pratiwi, 2016) for 15 s (Figure 1). The success of the DNA amplification process is influenced by primer concentration, denaturation duration, amplification temperature, DNA samples, and MgCl₂ concentration (Williams, 2005). PCR-RFLP product of CAST gene digestion by the Cfr13I enzyme produced GG genotype and the GA genotype in Bali cattle (Figure 2). GG genotype was homozygous genotype with fragments size of 282 bp and 342 bp, while genotype GA was heterozygous genotype with fragments size of 282 bp, 342 bp, and 624 bp. The digestion site of the Cfr13I enzyme was 5'-G|GNCC-3' shown in Figure 3. In comparison, GA genotype was not found in Belgian Blue, Wagyu, PO, and Limousin. The SNP c.100800G > A on the CAST gene was specific only found in Bali cattle. Li et al. (2010) reported that the GG genotype of the CAST gene was not found in Qinchuan cattle (Bos taurus). Braunvieh three-way cross (Bos indicus×Bos taurus) cattle in 5^th intron of the CAST gene produced two genotypes, there were CC genotype and CG genotype, while the GG genotype was not found in this cattle (Curi et al. 2010). The results of this study were the same as reported by Pratiwi (2016) that GG and GA genotypes were obtained because of transition mutation of the purine base guanine (G) with the purine base adenine (A). The mutation occurred at position 282 bp of the CAST gene fragment in Bali cattle. However, Putri et al. (2015) reported that the genotypes CAST gene GG and AG were found in Bali cattle. The GG genotype frequency was 0.850, higher than the GA genotype was 0.150, while the G and A allele frequencies were 0.923 and 0.077, respectively.

 

Figure 1 The result of Calpastatin gene PCR fragments in 1.5% agarose gel electrophoresis

Note: M (marker), 1-133 (number of animals)

 

Figure 2 The result of CAST/Cfr13I fragment restriction in 2% agarose gel electrophoresis

Note: M (marker), GG and GA (genotypes)

 

Figure 3 Digestion site of the Cfr13I enzyme on the CAST gene

 

The G allele frequency was higher than the A allele frequency because the AA genotype was not found in the Bali cattle population in this study. According to Putri et al. (2015) an allele polymorphic has a value ≥ 0.01, which indicated that Bali cattle was polymorphic, while Belgian Blue, Wagyu, PO, and Limousin were monomorphic (Table 1). The genetic diversity in the population based on allelic frequency measured by heterozygosity (Ismail et al. 2020). The observed heterozygosity (H_o) was 0.154 and the expected heterozygosity (H_e) was 0.142. Volkandari et al. (2017) reported that if H_o higher H_e means the population was diverse, this indicates that genetics in Bali cattle was diverse. Noor (2010) reported that genetic diversity could be used in the breeding program, where selection is necessary for a diverse population and crossing is necessary for a uniform population. Furthermore, if the H_o > H_e indicated random mating n the population, whereas if H_o < H_e indicated inbreeding (Chesnokov and Artemyeva, 2015). Therefore, random mating occurred in Bali cattle population, while other breeds of beef cattle could not be calculated because the allele was monomorphic. The population was in Hardy-Weinberg equilibrium (HWE) or not analyzed by chi-square test (ꭓ²). The population was stated to be balanced if the calculated ꭓ² value was smaller than ꭓ² table (P<0.05) (Allendorf et al. 2010). Bali cattle in this study were in the HWE, while breeds of beef cattle could not be calculated because the allele was monomorphic. The study indicated that the genetic frequency in Bali cattle in this study was in a balanced condition and the genetic frequency was relatively stable. Allendorf et al. (2010) reported that the population was in HWE because the genotypic and allelic frequency does not change from generation to generation. The results of ultrasound imaging of meat characteristics parameters (BFT, LDT, MS, and PIMF) are represented in Figure 4. The ultrasound can be carried out to determine carcass composition since the method was simple, viable, effective, fast, and accurate without sacrificing the animal (Lambe et al. 2010). Melendez and Marchello, (2014) reported that ultrasound could be utilized to presume carcass in cattle with 70-85% accuracy. Similarly, Jakaria et al. (2017) reported that the ultrasound could be applied to determine characteristics of carcass quality in Bali cattle with a high correlation coefficient ranged between 0.291-0.938. Association analysis was only performed on Bali cattle because Bali cattle were polymorphic, while Belgian Blue, Wagyu, PO, and Limousin cattle were not calculated due to the alleles were monomorphic. The mean value and standard deviation of each meat characteristics (BFT, LDT, MS, and PIMF) were shown in Table 2. Based on the Table 2, the LDT for GA genotype (53.03±6.10 mm) higher than GG genotype (51.99±5.03 mm). The BFT for GA genotype (2.38±1.03 mm) higher than GG genotype (2.19±0.82 mm). According to Putri et al. (2015) BFT range from 1 up to 5 mm classified as an ideal carcass for the traditional market in Indonesia. Moreover, for the MS and PIMF GA genotype were 1.24 ± 1.03 and 1.94 ± 1.03%, respectively better than the MS and PIMF of for the GG genotype were 1.17 ± 0.31 and 1.72 ± 1.03%, respectively. BFT in this study was higher, but MS and PIMF were lower than what have been reported by Pratiwi (2016) in the same SNP. This was because marbling is the last adipose tissue to be deposited in animals, although adipose tissue begins to be deposited during the weaning period (Hocquette et al. 2010). The results showed that the polymorphisms of SNP c.100800G > A with GG genotype and GA genotype in Bali cattle showed no significant association (P>0.05) with meat characteristics (LDT, BFT, MS, and PIMF). This might be the SNP is located in the intron region (non-coding RNAs). The non-coding RNA transcribed from the intron region was involved in different biological processes, including transcription control and post-transcription of gene expression affect the phenotypic alteration (Nakaya et al. 2007). The meat characteristics of GA genotype, which had average LDT, BFT, MS, and PIMF higher than GG genotype, despite not statistically significant. Moreover, calpain/calpastatin activity occurs during the postmortem, which plays a role in the myofibrillar protein degradation, and fewer sarcoplasmic proteome changes during aging (Guimarães et al. 2019). On the same SNP Pratiwi (2016) reported that the CAST gene associated rump thickness. Several studies had stated about the CAST gene in different SNP and different cattle. Li et al. (2013) described that the CAST gene had potential as a candidate gene for cooking loss and meat color in Yanbian cattle (Bos taurus). In Hanwoo cattle (Bos taurus), CAST: c.1985G > C had a significant impact on tenderness by using the Warner-Blatzler Shear Force (WBSF) method (Lee et al. 2014). Research by Li et al. (2010) explained that in Chinese Commercial Cattle, the CAST gene had no significant effect on slaughter weight, carcass weight, rib eye area (REA), raw shrinkage weight, MS, and BFT, but significantly influenced meat tenderness. In accordance with Curi et al. (2010) stated that the CAST|RsaI gene had no significant effect the REA, BFT, PIMF, and myofibrillar fragmentation index (MFI) in Chinese Commercial Cattle. Another study conducted by Enriquez-Valencia et al. (2017) reported that the CAST gene had no significant effect on REA, BFT, and total fat in Nellore cattle (Bos indicus). Putri et al. (2015) reported different results that CAST gene associated with LDT and BFT in Bali cattle.

 

Table 1 Genotypic frequencies, allelic frequencies, observed heterozygosity (H_o), expected heterozygosity (H_e) and Hardy-Weinberg equilibrium (c²)

NS: non significant α 0.05 (c² <3.84) and ND: not counted because the alleles were monomorphic.

 

Figure 4 Ultrasound of the 12-13^th ribs in (1) vertical/transversal and (2) horizontal/longitudinal positions

(a) back fat thickness; (b) longissimus dorsi thickness; (c) percentage of IMF measurement area 15 × 15 mm; (d ) IMF; (e) bone and (X) dermis

 

This might be due to the mutation site used in Putri et al. (2015) was different from that used in this study. Growth traits were featured by birth weight (BW), weaning weight (WW), yearling weight (YW), two years weight (TYW), and daily gain weight (DGW). The mean value and standard deviation of each growth traits were shown in Table 3. Based on the Table 3, the GA genotype has higher BW, WW, YW, TYW, and ADG than the GG genotype. This was due to the lower decomposition of fat during the growth period, and expand during the fattening period therefore the concentration of fat in muscle (IMF content) will rise (Hocquette et al. 2010). In addition, the increase in CAST activity may inhibit muscular fiber degradation, thereby resulting in the further accumulation of muscle mass (MacHado et al. 2020). The association of the SNP c.100800G > A CAST gene with growth traits included BW, WW, YW, TYW and DGW showed that GG genotype and GA genotype in Bali cattle showed no significant association (P>0.05) with growth traits. We assumed that the detection of polymorphisms was in the intron region (15^th intron) that causing silent mutations (Nikmard et al. 2012). We selected the partial sequence from 15^th up to16^th exons, while it seems these partial sequences have not been the appropriate parts for observation of polymorphism in Bali cattle.

 

Table 2 Association of CAST gene with with ultrasound imaging of meat characteristics Bali cattle

LDT: longissimus dorsi thickness; BFT: backfat thickness; MS: marbling score and PIMF: percentage of intramuscular fat/IMF.

NS: non significant.

 

Table 3 Association of CAST gene with growth traits in Bali cattle

BW: birth weight; WW: weaning weight; YW: yearling weight; TYW: two years weight and ADG: average daily gain.

NS: non significant.

 

Several studies in different animals reported by Gorlov et al. (2016) explained that the CAST|MspI gene was associated with BW, WW, and DGW in Salsk sheep. Whereas, Putri et al. (2015) described that the CAST|AluI gene was not associated with BW, shoulder height, chest circumference, body length, and ADG in Bali cattle. Calpains/calpastatin system plays a role in muscle cell migration and differentiation in the early stages of development (Dedieu et al. 2004; Moyen et al. 2004; Barnoy et al. 2005). Nevertheless, Pintos and Corva (2011) identified that the CAST gene had significant effect BW and WW in Argentinian Angus cattle. The absence of an association may be due to the small sample size of Bali cattle used in this study compared to the research of Pintos and Corva (2011) which used 1.365 Black and Red Angus bulls.

 

CONCLUSION

There was no polymorphism SNP c.100800G > A on the CAST gene observed in Belgian Blue, Wagyu, PO, and Limousin. The association study of SNP c.100800G > A on the CAST gene had no significant impact on the meat characteristics and growth traits using ultrasound. The SNP may not be purposed for a selection tool in Bali cattle. Therefore, the future study with a higher number of animals will be necessary to validate the effect of the SNP c.100800G > A on the CAST gene with the actual beef cutting of Bali cattle.

 

ACKNOWLEDGEMENT

This research was funded by the Ministry of Education and Culture for Master Thesis Research Scheme (PTM) with contract Number: 2834/IT3.L1/ PN/2020. The authors thank the head of Bali Cattle Breeding Centre (BPTU-HPT) in Bali Province, BPTU-HPT Padang Mangatas in West Sumatra Province, Animal Embryo Centre (BET) Cipelang, West Java province, Indonesia for the support and facilities provided during the research.

مراجع

Allendorf F.W., Hohenlohe P.A. and Luikart G. (2010). Genomics and the future of conservation genetics. Nat Rev. Genet. 11, 697-709.

Barnoy S., Maki M. and Kosower N.S. (2005). Overexpression of calpastatin inhibits L8 myoblast fusion. Biochem. Biophys. Res. Commun. 332, 697-701.

Busch W.A., Stromer M.H., Goll D.E. and Suzuki A. (1972). Ca²⁺-specific removal of Z lines from rabbit skeletal muscle. J. Cell Biol. 52, 367-381.

Calvo J.H., Iguácel L.P., Kirinus J.K., Serrano M., Ripoll G., Casasús I., Joy M., Pérez-velasco L., Sarto P., Albertí P. and Blanco M. (2014). A new single nucleotide polymorphism in the calpastatin (CAST) gene associated with beef tenderness. Meat Sci. 96, 775-782.

Chesnokov Y.V. and Artemyeva A.M. (2015). Evaluation of the measure of polymorphism information of genetic diversity. Agric. Biol. 50, 571-578.

Curi R.A., Chardulo L.A.L., Giusti J., Silveira A.C., Martins C.L. and de Oliveira H.N. (2010). Assessment of GH1, CAPN1 and CAST polymorphisms as markers of carcass and meat traits in Bos indicus and Bos taurus-Bos indicus cross beef cattle. Meat Sci. 86, 915-920.

Dedieu S., Poussard S., Mazerem G., Grise F., Dargelos E. and Cottin P. (2004). Myoblast migration is regulated by calpain through its involvement in cell attachment and cytoskeletal organization. Exp. Cell Res. 292, 187-200.

Enriquez-Valencia C.E., Pereira G.L., Malheiros J.M., de Vasconcelos Silva J.A.I.I., Albuquerque L.G., de Oliveira H.N., Chardulo L.A.L. and Curi R.A. (2017). Effect of the g.98535683A > G SNP in the CAST gene on meat traits of Nellore beef cattle (Bos indicus) and their crosses with Bos taurus. Meat Sci. 123, 64-66.

Ghamari Monavvar H., Moghaddam G. and Ebrahimi M. (2020). A review on the effect of arginine on growth performance, meat quality, intestine morphology, and immune system of broiler chickens. Iranian J. Appl. Anim. Sci. 10(4), 587-594.

Gorlov I.F., Shirokova N.V. and Randelin A.V. (2016). CAST/MspI gene polymorphism and its impact on growth traits of Soviet Merino and Salsk sheep breeds in the South European part of Russia. Turkish J. Vet. Anim. Sci. 40, 399-405.

Guimarães L., Oliveira D., Francisquine E., Steadham E.M., Hu E. and Lonergan S.M. (2019). Association of calpain and calpastatin activity to postmortem myofibrillar protein degradation and sarcoplasmic proteome changes in bovine Longissimus lumborum and Triceps brachii. Meat Sci. 155, 50-60.

Hashim H.O. and Al-Shuhaib M.B.S. (2019). Exploring the potential and limitations of PCR-RFLP and PCR-SSCP for SNP detection: A review. J. Appl. Biotechnol. Rep. 6, 137-144.

Hocquette J.F., Gondret F., Baza E., Mdale F., Jurie C. and Pethick D.W. (2010). Intramuscular fat content in meat-producing animals: Development, genetic and nutritional control, and identification of putative markers. Animal. 4, 303-319.

Ismail R., Handiwirawan E., Elieser S. and Jakaria J. (2020). Polymorphism of 5’UTR myostatin gene indel (g.1256/TTTTA) and its association with body weight in Boerka crossbred goat. J. Indonesian Trop. Anim. Agric. 45, 163-172.

Jakaria K.H., Priyanto R., Baihaqi M. and Ulum M.F. (2017). Prediction of meat quality in Bali cattle using ultrasound imaging. J. Indones. Trop. Anim. Agric. 42, 59-65.

Jr R.G.T., Cushman R.A., Mcneel A.K., Casas E., Smith T.P.L., Freetly H.C. and Bennett G.L. (2018). Theriogenology m-calpain (CAPN1), calpastatin (CAST), and growth hormone receptor (GHR) genetic effects on Angus beef heifer performance traits and reproduction. Theriogenology. 113, 1-7.

Kappes S.M., Keele J.W., Stone R.T., Mc Graw R.A., Sonstegard T.S., Smith T.P.L., Lopez-Corrales N.L. and Beatie C.W. (1997). A Second-generation linkage map of the bovine genome. Genome Res. 7, 235-249.

Kim T. (2015). T-test as a parametric statistic. Korean J. Anesthesiol. 68, 540-546.

Krzęcio E., Koćwin-Podsiadła M., Kurył J., Zybert A., Sieczkowska H., Antosik K. and Koc M. (2008). The effect of interaction between genotype CAST/RsaI (calpastatin) and MYOG/MspI (myogenin on carcass and meat quality in pigs free of RYR1 T allele. Meat Sci. 80, 1106-1115.

Lambe N.R., Ross D.W., Navajas E.A., Hyslop J.J., Prieto N., Craigie C., Bünger L., Simm G. and Roehe R. (2010). The prediction of carcass composition and tissue distribution in beef cattle using ultrasound scanning at the start and / or end of the finishing period. Livest. Sci. 131, 193-202.

Lee S., Kim S., Chai H., Cho S., Kim H., Lim D., Choi B., Dang C., Sharma A., Gondro C., Yang B. and Hong S. (2014). Mutations in calpastatin and μ-calpain are associated with meat tenderness , flavor, and juiciness in Hanwoo (Korean cattle): Molecular modeling of the effects of substitutions in the calpastatin/μ-calpain complex. Meat Sci. 96, 1501-1508.

Li Y.X., Jin H.G., Yan C.G., Seo K.S., Zhang L.C., Ren C.Y. and Jin X. (2013). Association of CAST gene polymorphisms with carcass and meat quality traits in Yanbian cattle of China. Mol. Biol. Reprod. 40, 1875-1881.

Li J., Zhang L., Gan Q., Li J., Gao H. and Yuan Z. (2010). Association of CAST gene polymorphisms with carcass and meat quality traits in chinese commercial cattle herds. Asian-Australian J. Anim. Sci. 23, 1405-1411.

MacHado A.L., Meira A.N., Muniz E.N., Azevedo H.C., Coutinho L.L., Mouraõ G.B., Pedrosa V.B. and Pinto L.F.B. (2020). Single loci and haplotypes in CAPN1 and CAST genes are associated with growth, biometrics, and in vivo carcass traits in Santa Inês sheep. Ann. Anim. Sci. 20, 465-483.

Melendez L.J. and Marchello J.A. (2014). The efficacy of ultrasound to determine certain carcass traits in Grains-fed beef cattle. Int. J. Sci. Comput. Hum. 2, 145-154.

Moonesinghe R., Yesupriya A., Chang M.H., Dowling N.F., Khoury M.J. and Scott A.J. (2010). A hardy-weinberg equilibrium test for analyzing population genetic surveys with complex sample designs. Am. J. Epidemiol. 171, 932-941.

Moyen C., Goudenege S., Poussard S., Sassi A.H., Brustis J.J. and Cottin P. (2004). Involvement of micro-calpain (CAPN1) in muscle cell differentiation. Int. J. Biochem. Cell Biol. 36, 728-43.

Nakaya H.I., Amaral P.P., Louro R., Lopes A., Fachel A.A., Moreira Y.B., El-Jundi T.A., da Silva A.M., Reis E.M. and Verjovski-Almeida S. (2007). Genome mapping and expression analyses of human intronic noncoding RNAs reveal tissue-specific patterns and enrichment in genes related to regulation of transcription. Genome Biol. 8, 4303-4325.

Nikmard M., Molaee V., Eskandarinasab M.P., Djadid N.D. and Vajhi A.R. (2012). Calpastatin polymorphism in Afshari sheep and its possible correlation with growth and carcass traits. J. Appl. Anim. Res. 40, 346-350.

Noor R.R. (2010). Genetika Ternak. Penebar Swadaya, Jakarta, Indonesia.

Palmer B.R., Roberts N., Hickford J.G.H. and Bickerstaffe R. (1998). Rapid Communications: PCR-RFLP for MspI and NcoI in the ovine calpastatin gene. American Soc. Anim. Sci. 76, 1499-1500.

Pereira F., Carneiro J. and Amorim A. (2008). Identification of species with DNA-based technology: current progress and challenges. Rec. Paten. DNA Gene Seq. 2, 187-199.

Pinto L.F., Ferraz J.B., Meirelles F.V., Eler J.P., Rezende F.M., Carvalho M.E., Almeida H.B. and Silva R.C. (2010). Association of SNPs on CAPN1 and CAST genes with tenderness in Nellore cattle. Genet. Mol. Res. 9, 1431-1442.

Pintos D. and Corva P.M. (2011). Association between molecular markers for beef tenderness and growth traits in Argentinian Angus cattle. Anim. Genet. 42, 329-332.

Pratiwi N. (2016). Analisis keragaman gen kalpastatin (CAST) dan kalpain-1 (CAPN1) terhadap karakteristik karkas dan daging pada sapi Bali. MS Thesis. Institut Pertanian Bogor Univ., Bogor, Indonesia.

Purwantara B., Noor R.R., Andersson G. and Rodriguez-Martinez H. (2012). Banteng and Bali cattle in Indonesia: Status and forecasts. Reprod. Domest. Anim. 47, 2-6.

Putri R., Priyanto R., Gunawan A. and Jakaria A. (2015). Association of calpastatin (CAST) gene with growth traits and carcass characteristics in Bali cattle. Med. Petern. 38, 145-149.

Raynaud P., Jayat-Vignoles C., Laforêt M.P., Levéziel H. and Amarger V. (2005). Four promoters direct expression of the calpastatin gene. Arch. Biochem. Biophys. 437, 69-77.

Raza S.H.A., Khan R., Abdelnour S.A., El-Hack M.E.A., Khafaga A.F., Taha A., Ohran H., Mei C., Schreurs N.M. and Zan L. (2019). Advances of molecular markers and their application for body variables and carcass traits in Qinchuan cattle. Gen. Basel. 10, 1-4.

SAS Institute. (2004). SAS^®/STAT Software, Release 9.4. SAS Institute, Inc., Cary, NC. USA.

Setiaji R., Prastowo S., Prasetio D. and Widyas N. (2019). Phenotypic and genetic correlations of growth traits in Bali cattle breeding population phenotypic and genetic correlations of growth traits in Bali cattle breeding population. Earth Environ. Sci. 372, 1-6.

Sun Y.L. and Lin C.S. (2003). Establishment and application of a fluorescent polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method for identifying porcine, caprine, and bovine meats. J. Agric. Food. Chem. 51, 1771-1776.

Suryanto E., Bulkaini B., Ashari A. and Karda I.W. (2014). Carcass quality, marbling and cholesterol content of male Bali cattle fed fermented cocoa shell. J. Indonesian Trop. Anim. Agric. 39, 249-255.

Tizioto P.C., Decker J.E., Taylor J.F., Schnabel R.D., Mudadu M.A., Silva F.L., Mourão G.B., Coutinho L.L., Tholon P., Sonstegard T.S., Rosa A.N., Alencar M.M., Tullio R.R., Medeiros S.R., Nassu R.T., Feijó G.L.D., Silva L.O.C., Torres R.A., Siqueira F., Higa R.H. and Regitano L.C.A. (2013). Genome scan for meat quality traits in nelore beef cattle. Physiol. Genom. 45, 1012-1020.

Van Ba H., Reddy B.V. and Hwang I. (2014). Role of calpastatin in the regulation of mRNA expression of calpain, caspase, and heat shock protein systems in bovine muscle satellite cells. In vitro Cell. Dev. Biol. Anim. 51, 447-454.

Volkandari S.D., Margawati E.T., Indriawati I. and Talib C. (2017). Identification SNPs 257 calpastatin gene associated with meat quality in buffalo. Semn. Biodovers. 6, 87-89.

Wawo A.A. (2018). Effect of bulls on birth rate and birth weight by using semi-intensive Bali cattle maintenance. Chalaza J. Anim. Husband. 3, 24-28.

Williams J.L. (2005). The use of marker-assisted selection in animal breeding and biotechnology. Rev. Sci. Tech. Off. Int. Epiz. 24, 379-391.

Wisesa A., Pemayun T. and Mahardika I. (2012). The D-loop DNA sequence analysis for the mitochondrial DNA of Bali cattle and Banteng compared with other cattle breeds in the world. Indonesian Med. Ver. 1, 281-292.